ID: 1081114659_1081114662

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1081114659 1081114662
Species Human (GRCh38) Human (GRCh38)
Location 11:39185073-39185095 11:39185089-39185111
Sequence CCAAAGATTGCCAGCAAACCACA AACCACAAGAATCTCTGAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 20, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!