ID: 1081173257_1081173263

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1081173257 1081173263
Species Human (GRCh38) Human (GRCh38)
Location 11:39893914-39893936 11:39893929-39893951
Sequence CCACCCTAGTTCTCCCCACACCC CCACACCCCCTCCCAAGTCTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 47, 4: 449} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!