ID: 1081195040_1081195044

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1081195040 1081195044
Species Human (GRCh38) Human (GRCh38)
Location 11:40151011-40151033 11:40151027-40151049
Sequence CCATGCTCCATATGCCTGCAAGA TGCAAGAGTATTTGTGTCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 176} {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!