ID: 1081207322_1081207330

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1081207322 1081207330
Species Human (GRCh38) Human (GRCh38)
Location 11:40291497-40291519 11:40291521-40291543
Sequence CCAAAGAAGTCCTCAGTTAGAAG GGGTGGAGTTGGAGAGAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 256} {0: 1, 1: 0, 2: 5, 3: 92, 4: 809}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!