ID: 1081227344_1081227351

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1081227344 1081227351
Species Human (GRCh38) Human (GRCh38)
Location 11:40540559-40540581 11:40540579-40540601
Sequence CCCTGACACCTCCACCTGCAGAG GAGTTCTAAAATTTAGGTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 442} {0: 1, 1: 1, 2: 0, 3: 11, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!