ID: 1081235051_1081235058

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1081235051 1081235058
Species Human (GRCh38) Human (GRCh38)
Location 11:40637000-40637022 11:40637028-40637050
Sequence CCCCTTAACCCTGCAACTGATTT TCTGGGCCCCCAGAGCAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 147} {0: 1, 1: 1, 2: 2, 3: 45, 4: 468}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!