|
Left Crispr |
Right Crispr |
| Crispr ID |
1081236586 |
1081236592 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:40654240-40654262
|
11:40654266-40654288
|
| Sequence |
CCAGACCCCAGAATGGTAGATCC |
GACATTTTGCACTGTGTGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1268, 1: 1929, 2: 1766, 3: 1012, 4: 639} |
{0: 1, 1: 0, 2: 21, 3: 246, 4: 685} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|