ID: 1081236589_1081236592

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1081236589 1081236592
Species Human (GRCh38) Human (GRCh38)
Location 11:40654247-40654269 11:40654266-40654288
Sequence CCAGAATGGTAGATCCACTGACA GACATTTTGCACTGTGTGCTGGG
Strand - +
Off-target summary {0: 857, 1: 1226, 2: 1663, 3: 1355, 4: 1012} {0: 1, 1: 0, 2: 21, 3: 246, 4: 685}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!