ID: 1081244468_1081244475

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1081244468 1081244475
Species Human (GRCh38) Human (GRCh38)
Location 11:40747050-40747072 11:40747088-40747110
Sequence CCTTTACCAGCTAACACTGATGC ACTGTTCTAGGGCCCAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122} {0: 1, 1: 0, 2: 1, 3: 9, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!