ID: 1081245647_1081245653

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1081245647 1081245653
Species Human (GRCh38) Human (GRCh38)
Location 11:40763602-40763624 11:40763653-40763675
Sequence CCACACTGTAGCAGTGTCTGTGT AGGGAAAGCACAGTGATTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 207} {0: 2, 1: 35, 2: 77, 3: 170, 4: 439}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!