|
Left Crispr |
Right Crispr |
Crispr ID |
1081252436 |
1081252446 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:40851431-40851453
|
11:40851477-40851499
|
Sequence |
CCACCCTGCTTCTGCTTACCCTC |
CTGGTCCCAGTGAGATGAACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 7, 1: 218, 2: 640, 3: 931, 4: 1220} |
{0: 2, 1: 7, 2: 140, 3: 392, 4: 551} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|