ID: 1081252978_1081252986

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1081252978 1081252986
Species Human (GRCh38) Human (GRCh38)
Location 11:40858416-40858438 11:40858460-40858482
Sequence CCAGGCACATGGTTCATGCCTAT TGAAGCAGGCAGATAACTTGAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 32, 3: 157, 4: 660} {0: 5, 1: 165, 2: 3073, 3: 12946, 4: 35164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!