ID: 1081266209_1081266211

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1081266209 1081266211
Species Human (GRCh38) Human (GRCh38)
Location 11:41025478-41025500 11:41025496-41025518
Sequence CCAATGTTCTAATTGTCTTCATT TCATTTCTATAAAGGCCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 490} {0: 1, 1: 0, 2: 0, 3: 13, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!