|
Left Crispr |
Right Crispr |
| Crispr ID |
1081299187 |
1081299192 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:41429298-41429320
|
11:41429328-41429350
|
| Sequence |
CCTTTATAAATTATCCAGTATTG |
CTTTATTAGCAGCATGAGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 141, 2: 1791, 3: 2909, 4: 4711} |
{0: 6, 1: 402, 2: 665, 3: 2357, 4: 2399} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|