ID: 1081405380_1081405386

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1081405380 1081405386
Species Human (GRCh38) Human (GRCh38)
Location 11:42691771-42691793 11:42691802-42691824
Sequence CCAGCAGCACATCAAGAACCCTA GATCAAGTTGGCTTCATCCCTGG
Strand - +
Off-target summary No data {0: 949, 1: 8621, 2: 4200, 3: 3299, 4: 3570}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!