ID: 1081435675_1081435677

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1081435675 1081435677
Species Human (GRCh38) Human (GRCh38)
Location 11:43024912-43024934 11:43024938-43024960
Sequence CCTGGGTGTGAGTTGTGGCTCTG CTTATGAGATGTGTGACCTGCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 24, 3: 195, 4: 1158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!