ID: 1081487102_1081487103

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1081487102 1081487103
Species Human (GRCh38) Human (GRCh38)
Location 11:43539249-43539271 11:43539269-43539291
Sequence CCTTTGCAGAGCTGCTAACTCAG CAGTTTCTGCATCTATAAAATGG
Strand - +
Off-target summary No data {0: 10, 1: 155, 2: 1189, 3: 4695, 4: 11388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!