|
Left Crispr |
Right Crispr |
| Crispr ID |
1081500953 |
1081500964 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:43666162-43666184
|
11:43666208-43666230
|
| Sequence |
CCCTCCATTTTCTCAATATCTGG |
ATTTTTATTTTTTTGAGGCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 1, 3: 22, 4: 268} |
{0: 10, 1: 313, 2: 2572, 3: 21411, 4: 31771} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|