ID: 1081508591_1081508594

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1081508591 1081508594
Species Human (GRCh38) Human (GRCh38)
Location 11:43744349-43744371 11:43744366-43744388
Sequence CCAATGATAAAAAAAAAAGCAGG AGCAGGTTACATAGAAATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 97, 4: 1089} {0: 1, 1: 0, 2: 3, 3: 15, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!