ID: 1081528357_1081528368

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1081528357 1081528368
Species Human (GRCh38) Human (GRCh38)
Location 11:43942369-43942391 11:43942413-43942435
Sequence CCTGTCCGGGCGCAGCTCGGGCC GGCTTCTCCCGGAACCCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 186} {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!