ID: 1081528523_1081528533

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1081528523 1081528533
Species Human (GRCh38) Human (GRCh38)
Location 11:43942879-43942901 11:43942911-43942933
Sequence CCGGCCCCGCAGACGCCGGAGGC GCCAAGCCCGGCGAGCTGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 202} {0: 1, 1: 0, 2: 1, 3: 4, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!