ID: 1081536733_1081536744

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1081536733 1081536744
Species Human (GRCh38) Human (GRCh38)
Location 11:44002158-44002180 11:44002188-44002210
Sequence CCTCCTTCCTCCTGTGTTACGTG ACCACCGGAAAGGGCCATTCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!