ID: 1081550369_1081550373

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1081550369 1081550373
Species Human (GRCh38) Human (GRCh38)
Location 11:44106163-44106185 11:44106207-44106229
Sequence CCTAGATTCATGGGGAAGGGACA AGAAGTACCATGCAAATTCAGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 21, 3: 107, 4: 477} {0: 1, 1: 0, 2: 1, 3: 15, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!