ID: 1081554544_1081554551

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1081554544 1081554551
Species Human (GRCh38) Human (GRCh38)
Location 11:44146221-44146243 11:44146271-44146293
Sequence CCTCATTTTCACTTAATCACCTC GTTACATTTTGAGATGCTAGGGG
Strand - +
Off-target summary {0: 3, 1: 76, 2: 316, 3: 909, 4: 1726} {0: 1, 1: 1, 2: 12, 3: 111, 4: 562}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!