ID: 1081554546_1081554551

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1081554546 1081554551
Species Human (GRCh38) Human (GRCh38)
Location 11:44146240-44146262 11:44146271-44146293
Sequence CCTCTTTGAAAAGGCCCTTTCTC GTTACATTTTGAGATGCTAGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 42, 4: 271} {0: 1, 1: 1, 2: 12, 3: 111, 4: 562}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!