ID: 1081561951_1081561953

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1081561951 1081561953
Species Human (GRCh38) Human (GRCh38)
Location 11:44225909-44225931 11:44225927-44225949
Sequence CCAAAGTGTGAGTCTTCTTATTA TATTATCCACAGAAGGCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 224} {0: 1, 1: 0, 2: 0, 3: 15, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!