ID: 1081565870_1081565873

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1081565870 1081565873
Species Human (GRCh38) Human (GRCh38)
Location 11:44260965-44260987 11:44260979-44261001
Sequence CCTAGCTCTATGTGTGTGAGTGA TGTGAGTGAAGAGGGAAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 335} {0: 1, 1: 1, 2: 5, 3: 77, 4: 880}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!