ID: 1081584758_1081584771

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1081584758 1081584771
Species Human (GRCh38) Human (GRCh38)
Location 11:44376704-44376726 11:44376748-44376770
Sequence CCCATCAGCTGGGTCCTGCTTGT CAGTGTGACCACACGGGGGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!