ID: 1081598075_1081598084

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1081598075 1081598084
Species Human (GRCh38) Human (GRCh38)
Location 11:44473093-44473115 11:44473133-44473155
Sequence CCTGCCCTGGTTAGCCAGCCTTG TGCAATCATACCCATGGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 175} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!