ID: 1081619876_1081619890

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1081619876 1081619890
Species Human (GRCh38) Human (GRCh38)
Location 11:44613182-44613204 11:44613233-44613255
Sequence CCCTGCCTTCTAGGGTCCCTCGC CATTTGCCCTGAAAGGTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 92} {0: 1, 1: 0, 2: 1, 3: 11, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!