ID: 1081626229_1081626233

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1081626229 1081626233
Species Human (GRCh38) Human (GRCh38)
Location 11:44656910-44656932 11:44656931-44656953
Sequence CCACTAAAGAGGTATGGAGCCAC ACAGTCAATAAGATGTGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!