ID: 1081639782_1081639792

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1081639782 1081639792
Species Human (GRCh38) Human (GRCh38)
Location 11:44744920-44744942 11:44744969-44744991
Sequence CCTGTTTTACCCAGGCTCAGCAG CGTCTGTCATGGTTGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 148} {0: 1, 1: 0, 2: 2, 3: 13, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!