ID: 1081655383_1081655398

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1081655383 1081655398
Species Human (GRCh38) Human (GRCh38)
Location 11:44853803-44853825 11:44853850-44853872
Sequence CCGGAGTGCAGAAGCAGCACCTC GCCTCCCGGTTCTGTGTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 364} {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!