ID: 1081657262_1081657271

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1081657262 1081657271
Species Human (GRCh38) Human (GRCh38)
Location 11:44865765-44865787 11:44865797-44865819
Sequence CCAGGCTAAAAGTCCTGAGGCTG GGTCTCAGTGGAGCAGGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 144} {0: 1, 1: 0, 2: 1, 3: 25, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!