ID: 1081669734_1081669740

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1081669734 1081669740
Species Human (GRCh38) Human (GRCh38)
Location 11:44936361-44936383 11:44936402-44936424
Sequence CCTAACGTGTGCATCTCAGGTTA TTCAAACAGAAGTGGCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 113} {0: 1, 1: 0, 2: 1, 3: 23, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!