ID: 1081670382_1081670395

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1081670382 1081670395
Species Human (GRCh38) Human (GRCh38)
Location 11:44939062-44939084 11:44939082-44939104
Sequence CCCCCACTCCCCCACCGCCAGCA GCAACATCTTGGACCAGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 138, 4: 1275} {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!