ID: 1081676772_1081676784

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1081676772 1081676784
Species Human (GRCh38) Human (GRCh38)
Location 11:44974559-44974581 11:44974597-44974619
Sequence CCACCCCCTTCCCCAGGGCTGAG CCTCCAGCCACCCGTGCCTCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 9, 3: 128, 4: 921} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!