ID: 1081702530_1081702539

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1081702530 1081702539
Species Human (GRCh38) Human (GRCh38)
Location 11:45161240-45161262 11:45161269-45161291
Sequence CCCAGGGTGTCTTCTCTGAATGA GATCCCACCTCCATGGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 177} {0: 1, 1: 0, 2: 1, 3: 22, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!