ID: 1081723464_1081723473

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1081723464 1081723473
Species Human (GRCh38) Human (GRCh38)
Location 11:45307004-45307026 11:45307044-45307066
Sequence CCCATGCTACTTGAGGTGGGGCC CTCTCCATTTCCTTCCTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 85} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!