ID: 1081741348_1081741354

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1081741348 1081741354
Species Human (GRCh38) Human (GRCh38)
Location 11:45443210-45443232 11:45443241-45443263
Sequence CCCCAGGGTCCCAGAGAATCCAG TTAGCACCTCCATGCACTGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!