ID: 1081802749_1081802753

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1081802749 1081802753
Species Human (GRCh38) Human (GRCh38)
Location 11:45870909-45870931 11:45870950-45870972
Sequence CCAGGCTGGCAGCATGAGCAGTG CAACCTCCTGTGGCCTCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 70, 4: 329} {0: 1, 1: 0, 2: 5, 3: 35, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!