ID: 1081806225_1081806232

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1081806225 1081806232
Species Human (GRCh38) Human (GRCh38)
Location 11:45892247-45892269 11:45892277-45892299
Sequence CCAGCACCGTCTTCCCAGAGGAC CCTAGCCCAGACTCTGGTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 189} {0: 1, 1: 0, 2: 2, 3: 16, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!