ID: 1081814327_1081814333

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1081814327 1081814333
Species Human (GRCh38) Human (GRCh38)
Location 11:45930022-45930044 11:45930041-45930063
Sequence CCACCATCCATCTCATTACCCTA CCTAAGAGCCTTTTGCCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 268} {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!