ID: 1081814406_1081814408

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1081814406 1081814408
Species Human (GRCh38) Human (GRCh38)
Location 11:45930440-45930462 11:45930454-45930476
Sequence CCTATGTCAGGTACAACCAGCAG AACCAGCAGGCTTACCCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 117} {0: 1, 1: 1, 2: 2, 3: 5, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!