ID: 1081832788_1081832799

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1081832788 1081832799
Species Human (GRCh38) Human (GRCh38)
Location 11:46128191-46128213 11:46128239-46128261
Sequence CCACCTCGGCCTCCCAAAGTGCT CTCGGCCTCACTGGATTGTTTGG
Strand - +
Off-target summary {0: 87986, 1: 182858, 2: 138884, 3: 74939, 4: 51691} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!