ID: 1081832795_1081832797

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1081832795 1081832797
Species Human (GRCh38) Human (GRCh38)
Location 11:46128204-46128226 11:46128230-46128252
Sequence CCAAAGTGCTGGGATTACAGGTG GCCACTGCACTCGGCCTCACTGG
Strand - +
Off-target summary {0: 68945, 1: 203244, 2: 249087, 3: 204446, 4: 175427} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!