ID: 1081851724_1081851739

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1081851724 1081851739
Species Human (GRCh38) Human (GRCh38)
Location 11:46278733-46278755 11:46278760-46278782
Sequence CCCACCCCAGGGAGGGACCTGAG GGGGCTGGGAAGAGGCGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 370} {0: 1, 1: 0, 2: 2, 3: 59, 4: 620}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!