ID: 1081866513_1081866519

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1081866513 1081866519
Species Human (GRCh38) Human (GRCh38)
Location 11:46363366-46363388 11:46363381-46363403
Sequence CCTCCCCAGACACACAGGGAAAC AGGGAAACTGAGGCCCGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 499} {0: 1, 1: 2, 2: 24, 3: 178, 4: 898}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!