ID: 1081869112_1081869117

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1081869112 1081869117
Species Human (GRCh38) Human (GRCh38)
Location 11:46375298-46375320 11:46375320-46375342
Sequence CCCTCTGCCCTCTGGCCAGGGGT TCACTCTCACCTTTGTTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 402} {0: 1, 1: 0, 2: 3, 3: 38, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!