ID: 1081872650_1081872658

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1081872650 1081872658
Species Human (GRCh38) Human (GRCh38)
Location 11:46390614-46390636 11:46390643-46390665
Sequence CCAGTTTCTCACGCTAGGGTCGG CTCGAGGGCCGTGTTTTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28} {0: 1, 1: 0, 2: 1, 3: 0, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!